Global Alert and Response (GAR)

PCR primers for SARS developed by WHO Network Laboratories

17 April 2003

The following 7 primers have been developed by and used in several of the WHO network laboratories to amplify the polymerase gene of the coronavirus likely to be responsible of SARS. They are currently being studied for relative performance and sensitivity in different specimens at different time of sampling in the course of illness. A representative amplicon is also included in this website.

Results and recommendations on primers will be published as soon as available. Positive control RNA can be obtained free of charge from the Bernhard-Nocht Institute in Hamburg, Germany.

Results of PCR using these primers can be used to complement clinical diagnostic evaluation. However, tests have not been validated for confirmation of cases or exclusion of the disease. The WHO case definition remains unchanged at present. Guidelines on sample handling of suspected or probable SARS patients, can be found in WHO biosafety guidelines for handling of SARS specimens.


Bernhard-Nocht Institute
Bernhard-Nocht Str. 74
D-20359 Hamburg
Germany

BNIoutS/BNoutAs:
sense ATGAAT TAC CAA GTC AAT GGT TAC
antisense CAT AAC CAG TCG GTA CAG CTA C
FraGment lenGth 195 bp

BNIinS/BNIAs:
sense GAA GCT ATT CGT CAC GTT CG
antisense CTGTAGAAA ATC CTA GCT GGA G
Fragment length 110 bp

SAR1s/SAR1as:
sense CCT CTC TTG TTC TTG CTC GCA
antisense TAT AGT GAG CCG CCA CAC ATG
Fragment length 150 bp

Amplicon sequence (BNI-1, Bernhard-Nocht Institute, Hamburg, Germany)
TACCGTAGACTCATCTCTATGATGGGTTTCAAAATGAATTACCA
AGTCAATGGTTACCCTAATATGTTTATCACCCGCGAAGAAGCTAT
TCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGGGCTGTCAT
GCAACTAGAGATGCTGTGGGTACTAACCTACCTCTCCAGCTAGGA
TTTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTATGTTGA
CACTGAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCC
ACCAGGTGACCAGTTTAAACATCTTATACC

More information


Centers for Disease Control & Prevention
National Centers for Infectious Diseases,
Atlanta GA 30333
1600 Clifton Road, NE, MS-C12
United States

SARS-specific primers:
Cor-p-F2 (+) 5'CTAACATGCTTAGGATAATGG 3',
Cor-p-F3 (+) 5'GCCTCTCTTGTTCTTGCTCGC 3',
Cor-p-R1 (-) 5'CAGGTAAGCGTAAAACTCATC 3',
Product size:
Cor-p-F2/Cor-p-R1 :368 bp
Cor-p-F3/Cor-p-R1 :348 bp

- More Information


Government Virus Unit
9/F Public Health Laboratory Centre

382 NAm Cheong Street
Shek Kip Mei
Kowloon, Hong Kong SAR
Hong Kong - SAR China

COR-1,COR-2:
sense 5' CAC CGT TTC TAC AGG TTA GCT AAC GA 3'

antisense 5' AAA TGT TTA CGC AGG TAA GCG TAA AA 3'

Product size: 310 bp



Queen Mary Hospital
The University of Hong Kong
University Pathology Building
Hong Kong - SAR China



HKU:
sense 5' TACACACCTCAGCGTTG 3'

antisense 5' CACGAACGTGACGAAT 3'

Product size 182 bps


Share